GeneticsLab for iOS Support

This guide will show you how to perform the most common tasks in GeneticsLab. Please, select one of the help topics on the list to begin. We hope you enjoy GeneticsLab!


Welcome to GeneticsLab

This documentation site will help you getting started with the basic GeneticsLab for iOS workflow. Select one of the help topics on the list to display the associated help content.

Other learning resources

We're planning to add more documentation regarding to the genetic code and some of the basic principles of molecular biology in the future. Meanwhile, here you have a few links to some resources that can be useful for you if you have a any doubt related to these concepts:

Documentation is also available in other languages:

English Español Català

Go back to top
The GeneticsLab workspace

The workspace view

The editor view is the first screen you see when you've just opened the app. Here is where you can work with your DNA or RNA sequences, which you can type or paste in the input field. When the text on the input field changes, GeneticsLab does 4 things:

  • Automatically formats your sequence to display as triplets or another style of your choice. See 'Settings' for more details on this.
  • Invalid characters are colored in red. They are ignored in further processing. You may also see blue-colored characters representing extended symbols. See 'Settings' for more details on this.
  • Updates the base count indicator to show you how many symbols you've already got.
  • Generates the RNA transcription and amino acid translation corresponding to your input sequence.

Interface elements

  1. Input sequence field: Here is where you can type or paste your sequence.
  2. Output RNA sequence field: Transcribed RNA will show up here, according to your input mode.
  3. Output amino acid sequence field: Amino acids translated from the output RNA will show up here.
  4. Input mode indicator: Its text indicates which input mode is being used to parse your sequence. Tap on it to display a list of possible input modes.
  5. Settings button: Tap this button to access app settings screen and customize your experience.
  6. Mendelian inheritance calculator button: This button launches the mendelian inheritance calculator.
  7. Reference library button: This button displays the reference library.
  8. Discard document button: Use this button to clear the contents of the input field.
  9. Symbol count indicator: This label will show you how many nucleotides are in your sequence.
  10. Statistics button: This button displays the statistics screen.
  11. Issues button: This button displays the issues screen.
  12. Share button: Use this button to print or share your sequence via mail, social networks or any other apps installed on your iOS device.

Available input modes

  • DNA+: This is the default mode. It assumes your input is the sense DNA string, so output RNA will be generated directly. In this mode, typed U characters are interpreted as T.
  • DNA-: This mode assumes your input is the complementary DNA string, so output RNA will be generated from a complementary string. In this mode, typed U characters are interpreted as T.
  • RNA+: This mode assumes your input is the RNA string, so no processing is done here. In this mode, typed T characters are interpreted as U.
  • RNA-: This mode assumes your input is the complementary RNA string, so output RNA will be generated from a complementary string. In this mode, typed T characters are interpreted as U.
  • cDNA: This mode assumes your input is a DNA-complementary version of the mRNA string that will be generated, so it behaves just like the DNA- mode.
Go back to top
The GeneticsLab Workspace


Interface elements


Input methods

The issue inspector

Detecting and solving common errors in DNA, RNA and amino acid sequences is one of the most powerful GeneticsLab features. You may reach the issue inspector by tapping the second button from the bottom right corner on the Workspace view. By the moment, the analyzer can detect and solve three kind of issues:

  • Invalid input characters. This includes any character not being an A, C, G, T, U or any of the extended genetic code characters if its use is allowed.
  • Ambiguous amino acid generation. This happens when a parsed codon does not have enough information to code for a concrete amino acid. Note that some codons may still translate into an amino acid if their third base is not set to A, C, G or T; since the genetic code is actually degenerated. However, being too unspecific might lead to an ambiguous translation.

Fixing issues

Go back to top
The issues screen

Sequence statistics

The sequence statistics screen allows you to get information about the different symbol proportions in your sequence. You may reach the issue inspector by tapping the third button from the bottom right corner on the Workspace view.

Each row shows the symbol proportions both in absolute and percentage units.

Go back to top
Sequence statistics

Sequence processing settings

The settings screen allows you to customize the way your input sequences are formatted and processed. You may reach the settings pane by tapping button on the top right corner in the Workspace view.

Here are some of the customizable elements:

  1. Spacing: Use this control to customize how the input sequences are formatted. Here is the same sequence using the 3 different spacing modes:
    • None
      ATGATGATGATGATGATGATGATGATGGGTGATGCTGATCGATCGTAGGATACC
    • Triplets (default)
      ATG ATG ATG ATG ATG ATG ATG ATG ATG GGT GAT GCT GAT CGA TCG TAG GAT ACC
    • 10 b
      ATGATGATGA TGATGATGAT GATGATGGGT GATGCTGATC GATCGTAGGA TACC
  2. Amino acid style: Use this control to customize how the amino acid sequences are displayed. Here is the same sequence using the 2 different styles:
    • 1 letter
      MGLVALPQRVTTIYEVSHF|MHGFEGG|
    • 3 letters (default)
      Met Gly Leu Val Ala Leu Pro Gln Arg Val Thr Thr Ile Tyr Glu Val Ser His Phe END Met His Gly Phe Glu Gly Gly END
  3. Allow extended characters: You can use this switch to enable or disable parsing of extended character from the genetic code. Yoy may find more information about these characters in the table on this page. When disabled, extended characters are handled as invalid characters. Please note that using these characters incorrectly may lead to ambiguous translation results.
  4. Genetic code: The universal genetic code should be enough for most users. However, if you need to use any alternative genetic code such as the vertebrate mitochondrial code, you may use this control to switch between the different rules.
Go back to top
The settings screen


Extended character meanings
BNot A
DNot C
HNot G
KKeto
MAmino
NAny base
RPurine
SStrong
VNot T/U
WWeak
YPyrimidine

The reference library

If you're a beginner or you don't remember something about a concrete nucleotide or an amino acid, the reference library might be a quick and useful reference tool. You may launch the reference library by tapping the 'Reference library' button (the 2nd from the bottom left corner) in the 'Workspace' view.

This will bring up a list of the 20 common amino acid molecules. You may also switch to a list of nucleotides by tapping on the segmented control place at the top. From here, if you tap on any molecule on the list, you'll be redirected to a detailed page, where you will have:

  • A 2D representation of the selected molecule.
  • The full name of this molecule in your language, as so as its standard abbreviated names.
  • The 'More...' button. Tap it to check out the article corresponding to the selected molecule in Wikipedia.
Go back to top
Reference center

The mendelian inheritance calculator

This is a simple yet powerful GeneticsLab addition. With this tool, you will be able to perform some basic calculations based on mendelian inheritance patterns. Just type in the input parameters and press the "Calculate offspring" button to get the results! By now, GeneticsLab offers inheritance calculation from two individuals. These are the parameters you must specify:

  • Allele names: You can name your alleles however you want, though single letter names are preferred. If you don't specify these names, 1 and 2 will be used instead.
  • Allele dominance mode: You can set each allele to be dominant (that is, it will be expressed even in heterozygous individuals) or recessive (it won't be expressed on heterozygous individuals). If you enable both or none of them, co-dominance will be assumed and the hybrid phenotype will be assigned to heterozygous offspring.
  • Phenotype names: The name for the phenotype associated with each allele. Optionally, you can also specify a mixed or hybrid phenotype to be assigned when co-dominance takes place.
  • Parents' genotypes: Here is where you have to configure each progenitor's alleles before calculating their possible offspring. You may do so by selecting the desired option in each segmented control.
Go back to top
Mendelian inheritance calculator


Mendelian inheritance calculator results

Still have questions?

If you have any questions, complaints or suggestions, please do not hesitate to contact me.